mCerulean N1
(Plasmid #27795)

• Depositing Lab: Steven Vogel
• Publication: Koushik et al Biophys J. 2006 Dec 15. 91(12):L99-L101.

Backbone

• Vector backbone: pECFP N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3984
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCerulean N1
• Alt name: mCerulean-N1
• Insert Size (bp): 720

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CCAAAATCAACGGGACTTTCC
• 3′ sequencing primer: CAGGTTCAGGGGGAGGTGTGG

Resource Information

• Supplemental Documents:
  • Annotated Genbank file
• Articles Citing this Plasmid:
  • 10 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct was created by mutagenesis of pECFP-N1. When compared with ECFP, Cerulean contains the following mutations: S72A, Y145A and H148D. This construct also contains A206K mutation to create a monomeric form of the fluorescent protein.

See Addgene's sequencing results for detailed MCS and mCerulean. This plasmid is designed to clone a gene of interest upstream and in-frame to create a C-terminal mCerulean fusion protein.