VCVV
(Plasmid #27789)

• Depositing Lab: Steven Vogel
• Publication: Koushik et al PLoS One. 2009 . 4(11):e8031.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3940
• Vector type: Mammalian Expression ; Stoichiometry standard

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Venus-Cerulean-Venus-Venus
• Alt name: VCVV
• Insert Size (bp): 2826

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CCAAAATCAACGGGACTTTCC
• 3′ sequencing primer: CAGGTTCAGGGGGAGGTGTGG

Resource Information

• Addgene Notes:
  • Addgene's diagnostic digest
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 1st Venus can be excised using a NheI-BSP E1 double digest; Cerulean by BSP E1-BglII; the 2nd Venus by BglII-SalI and the last (3rd) Venus by SalI-BamHI. The full insert can be released by a NheI-BamHI double-digest.

Due to the multiple fluorescent protein repeats in this plasmid, Addgene is unable to confirm the entire insert by sequencing. Please see Addgene's diagnostic digest for this plasmid by clicking the Notes from Addgene link above.