Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CVC
(Plasmid #27809)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 27809 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP C1
  • Backbone size w/o insert (bp) 3984
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cerulean Venus Cerulean
  • Alt name
    CVC
  • Insert Size (bp)
    2160
  • GenBank ID
    U55763

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe 1 (not destroyed)
  • 3′ cloning site Bam HI (not destroyed)
  • 5′ sequencing primer CCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CVC was a gift from Steven Vogel (Addgene plasmid # 27809 ; http://n2t.net/addgene:27809 ; RRID:Addgene_27809)
  • For your References section:

    Quantitative multiphoton spectral imaging and its use for measuring resonance energy transfer. Thaler C, Koushik SV, Blank PS, Vogel SS. Biophys J. 2005 Oct . 89(4):2736-49. 10.1529/biophysj.105.061853 PubMed 16040744
Commonly requested with: