pTRKH3-slpGFP
(Plasmid #27168)

• Depositing Lab: Michela Lizier
• Publication: Lizier et al FEMS Microbiol Lett. 2010 Jul 1. 308(1):8-15.

Backbone

• Vector backbone: pTRKH3
• Backbone size w/o insert (bp): 7493
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Erythromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: surface (S)-layer protein promoter region fused with modified green fluorescent protein 5
• Alt name: Lactobacillus acidophilus slp promoter
• Alt name: synthetic construct mgfp5
• Species: Lactococcus lactis and synthetic construct
• Insert Size (bp): 1065

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: AGTGAAAAGTTCTTCTCCTT
• 3′ sequencing primer: GCGGCACGACTTCTTCAAGAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry