pDREV-0
(Plasmid #26750)

• Depositing Lab: Rolf Zeller
• Publication: Osterwalder et al Nat Methods. 2010 Oct 17

Backbone

• Vector backbone: pL1L2_gt0
• Backbone manufacturer: B. Rosen and W.C.Skarnes, unpublished
• Backbone size w/o insert (bp): 4500
• Vector type: Mammalian Expression, Cre/Lox ; FLP/FRT; DRE/Rox
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Nourseothricin (clonNat), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H2B-Venus CDS
• Alt name: HIST1H2BB, H2B.1, H2B/f, H2BFF, MGC119804
• Species: H. sapiens (human)
• Insert Size (bp): 1101
• GenBank ID: NM_021058
• Entrez Gene: H2BC3 (a.k.a. H2B.1, H2B/f, H2BFF, HIST1H2BB)
• Tag / Fusion Protein:
  • Venus (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BlgII (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: FCHK2 sequence: GTATCTGCAACCTCAAGCTAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: PGK-Puro cassette from Addgene plasmid 11349

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The pDREV plasmid series encode a 5' FRT site and a 3' loxP site for re-engineering of the IKMC knock-out first alleles by dual RMCE (dRMCE) as described in Osterwalder et al. "Dual RMCE for efficient re-engineering of mouse mutant alleles" Nature Methods (2010) DOI 10.1038/nmeth.1521

Protocol for using these plasmids can be found here: http://www.nature.com/protocolexchange/protocols/1906