HRE-luciferase
(Plasmid #26731)

• Purpose: Luciferase reporter construct containing three hypoxia response elements (24-mers) from the Pgk-1 gene.
• Depositing Lab: Navdeep Chandel
• Publication: Emerling et al Proc Natl Acad Sci U S A. 2008 Feb 19. 105(7):2622-7.

Backbone

• Vector backbone: pGL2
• Backbone manufacturer: Promega
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Hypoxia Responsive Elements (3)
• Tag / Fusion Protein:
  • Luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: unknown
• 3′ sequencing primer: Luc_N_Rev

Resource Information

• Articles Citing this Plasmid:
  • 80 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Three hypoxia response elements (24-mers) from the Pgk-1 gene upstream of firefly luciferase.

HRE: TGTCACGTCCTGCACGACTCTAGT

Note that one of the elements is a 22/24 match for the above sequence. This difference is not known to affect function.