C32V
(Plasmid #26396)

• Depositing Lab: Steven Vogel
• Publication: Koushik et al Biophys J. 2006 Dec 15. 91(12):L99-L101.

Backbone

• Vector backbone: EGFP N1
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 3937
• Vector type: Mammalian Expression ; FRET standard
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cerulean-32-Venus
• Alt name: C32V
• Insert Size (bp): 1533
• Tags / Fusion Proteins:
  • Cerulean (N terminal on insert)
  • Venus (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bam H1 (not destroyed)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: CCAAAATCAACGGGACTTTCC
• 3′ sequencing primer: CAGGTTCAGGGGGAGGTGTGG

Resource Information

• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct contains Cerulean attached via a 32 amino acid linker to Venus. See supplemental methods section in associated paper for further details of plasmid construction.