pBRPyCAG-fmKlf4-DsRed-Ip
(Plasmid #26274)

• Depositing Lab: Rudolf Jaenisch
• Publication: Hanna et al Proc Natl Acad Sci U S A. 2010 May 18. 107(20):9222-7.

Backbone

• Vector backbone: pBRYCAG-floxStop dsRED-IresPuro
• Backbone size w/o insert (bp): 8050
• Vector type: Mammalian Expression, Cre/Lox
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Klf4
• Species: M. musculus (mouse)
• Insert Size (bp): 1450
• Entrez Gene: Klf4 (a.k.a. EZF, Gklf, Zie)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: gtccccttctccctctccagcctcgg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry