pXN-FBLWLF-LexA
(Plasmid
#26266)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26266 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXN-FBLWLF
- Backbone size w/o insert (bp) 8757
-
Vector typeBacterial Expression, Insect Expression ; Drosophila transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLexA
-
SpeciesE. coli
-
Insert Size (bp)1471
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer CAGTGCACGTTTGCTTGTTGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXN-FBLWLF-LexA was a gift from Tom Clandinin (Addgene plasmid # 26266 ; http://n2t.net/addgene:26266 ; RRID:Addgene_26266) -
For your References section:
A versatile in vivo system for directed dissection of gene expression patterns. Gohl DM, Silies MA, Gao XJ, Bhalerao S, Luongo FJ, Lin CC, Potter CJ, Clandinin TR. Nat Methods. 2011 Mar;8(3):231-7. doi: 10.1038/nmeth.1561. 10.1038/nmeth.1561 PubMed 21473015