-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25794 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemCol.loxneo
- Backbone size w/o insert (bp) 10600
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOct4-P2A-Sox2-T2A-Klf4-E2A-cMyc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)5000
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer tagagaaaagtgaaagtcgagtttac (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCol.4F2A targeting construct was a gift from Rudolf Jaenisch (Addgene plasmid # 25794 ; http://n2t.net/addgene:25794 ; RRID:Addgene_25794) -
For your References section:
Single-gene transgenic mouse strains for reprogramming adult somatic cells. Carey BW, Markoulaki S, Beard C, Hanna J, Jaenisch R. Nat Methods. 2010 Jan . 7(1):56-9. 10.1038/nmeth.1410 PubMed 20010831