pCerulean
(Plasmid #24756)

• Depositing Lab: Martin Fraunholz
• Publication: Paprotka et al J Microbiol Methods. 2010 Aug 10. ():.

Backbone

• Vector backbone: pALC2084
• Backbone manufacturer: Ambrose Cheung
• Backbone size w/o insert (bp): 6500
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Chloramphenicol in S. aureus
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cerulean
• Species: synthetic
• Insert Size (bp): 720

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ctaatgcgctgttaatcactttac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: derived from cpGFP1 by Maureen Hanson (NY, USA); cite: Reed, M.L., Wilson, S.K., Sutton, C.A. and Hanson, M.R. (2001). High-level expression of a synthetic red-shifted GFP coding region incorporated into transgenic chloroplasts. Plant J 27, 257-265.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry