VPS13B^GFP
(Plasmid
#224588)
-
Purposecodon optimized GFP tagged VPS13B for expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDNA
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVPS13B^GFP
-
SpeciesH. sapiens (human)
-
Entrez GeneVPS13B (a.k.a. BLTP5B, CHS1, COH1)
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BAMHI (not destroyed)
- 3′ cloning site BAMHI (not destroyed)
- 5′ sequencing primer GGCGATGCGTTCCCTTGGAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis was synthesized by Genscript.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.12.18.572081 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VPS13B^GFP was a gift from Pietro De Camilli (Addgene plasmid # 224588 ; http://n2t.net/addgene:224588 ; RRID:Addgene_224588) -
For your References section:
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1. Ugur B, Schueder F, Shin J, Hanna MG, Wu Y, Leonzino M, Su M, McAdow AR, Wilson C, Postlethwait J, Solnica-Krezel L, Bewersdorf J, De Camilli P. bioRxiv [Preprint]. 2023 Dec 18:2023.12.18.572081. doi: 10.1101/2023.12.18.572081. 10.1101/2023.12.18.572081 PubMed 38187698