Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

IST1-GFP
(Plasmid #186298)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186298 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Total vector size (bp) 5604
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IST1 homolog
  • Alt name
    CHMP8m IST1, hIST1, PM28
  • Species
    H. sapiens (human)
  • Mutation
    GFP
  • Entrez Gene
    IST1 (a.k.a. CHMP8, OLC1)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic gene

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    IST1-GFP was a gift from Geert van den Bogaart (Addgene plasmid # 186298 ; http://n2t.net/addgene:186298 ; RRID:Addgene_186298)
  • For your References section:

    Giant worm-shaped ESCRT scaffolds surround actin-independent integrin clusters. Stempels FC, Jiang M, Warner HM, Moser ML, Janssens MH, Maassen S, Nelen IH, de Boer R, Jiemy WF, Knight D, Selley J, O'Cualain R, Baranov MV, Burgers TCQ, Sansevrino R, Milovanovic D, Heeringa P, Jones MC, Vlijm R, Ter Beest M, van den Bogaart G. J Cell Biol. 2023 Jul 3;222(7):e202205130. doi: 10.1083/jcb.202205130. Epub 2023 May 18. 10.1083/jcb.202205130 PubMed 37200023