pCF1148
(Plasmid
#222330)
-
PurposeFluorescent reporter plasmid for Veillonella
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222330 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepBSJL2
- Backbone size w/o insert (bp) 7769
-
Modifications to backboneThe tetM and bla antibiotic resistance cassettes and f1 phage origin were replaced with the cat gene and promoter from pRPF185 (Addgene #106367).
-
Vector typeBacterial Expression ; E. coli-Veillonella shuttle plasmid
-
Selectable markersselect with chloramphenicol analog thiamphenicol (15 µg/ml) in Veillonella
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebs2 gene with Veillonella parvula SKV38 mdh promoter
-
Alt nameFbFP, flavin mononucleotide-binding fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter Veillonella parvula SKV38 mdh promoter
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CTCATACTAGTGGATCCAAAAATACCAAAATTCTTCAAAAAAATC
- 3′ sequencing primer GATATTGTGTCCTGGGATCCCTGCAGTTATTCTAATAATTTTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe Bs2 gene was originally described in Drepper, T., et al. (2007) Reporter proteins for in vivo fluorescence without oxygen. Nature biotechnology 25, 443-445.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCF1148 was a gift from J Christopher Fenno (Addgene plasmid # 222330 ; http://n2t.net/addgene:222330 ; RRID:Addgene_222330) -
For your References section:
Development of a small shuttle plasmid for use in oral Veillonella and initial appraisal of potential for fluorescence-based applications. Goetting-Minesky MP, Kim J, White DT, Hayashi M, Rickard AH, Fenno JC. Lett Appl Microbiol. 2024 Aug 5;77(8):ovae069. doi: 10.1093/lambio/ovae069. 10.1093/lambio/ovae069 PubMed 39020263