pCSC-NGN2-IRES-ISL1-T2A-LHX3
(Plasmid #221814)

• Purpose: Lentiviral vector expressing human NEUROG2, ISL1 and LHX3 for inducing pluripotent stem cells into cholinergic motor neurons.
• Depositing Lab: Baojin Ding
• Publication: Sepehrimanesh et al Am J Physiol Cell Physiol. 2020 Oct 1;319(4):C771-C780. doi: 10.1152/ajpcell.00279.2020. Epub 2020 Aug 12.

Backbone

• Vector backbone: Lentiviral vector
• Backbone size w/o insert (bp): 9861
• Total vector size (bp): 12228
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: NEUROG2
• Alt name: NGN2
• Species: H. sapiens (human)
• Insert Size (bp): 2016
• GenBank ID: NM_024019.4
• Entrez Gene: NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (not destroyed)
• 3′ cloning site: XbaI (destroyed during cloning)
• 5′ sequencing primer: agctcgtttagtgaaccgtcagatc
• 3′ sequencing primer: cgtcttttggcaatgtgagg

Gene/Insert 2

• Gene/Insert name: ISL1
• Species: H. sapiens (human)
• Insert Size (bp): 1158
• GenBank ID: NM_002202.3
• Entrez Gene: ISL1 (a.k.a. ISLET1, Isl-1)

Gene/Insert 3

• Gene/Insert name: LHX3
• Species: H. sapiens (human)
• Insert Size (bp): 1209
• GenBank ID: NM_178138.6
• Entrez Gene: LHX3 (a.k.a. CPHD3, LIM3, M2-LHX3)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry