pPB-EF1A-Puro-mCherry-RAB7
(Plasmid #221555)

• Purpose: Expresse Cherry-tagged human Rab7 in mammalian cells. Compatible with piggybac transposase for genome integration.
• Depositing Lab: Shawn Ferguson
• Publication: Talaia et al bioRxiv [Preprint]. 2023 Dec 17:2023.12.16.571979. doi: 10.1101/2023.12.16.571979.

Backbone

• Vector backbone: pPB
• Backbone manufacturer: Vectorbuilder
• Vector type: Mammalian Expression ; piggybac
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rab7A
• Alt name: Rab7
• Species: H. sapiens (human)
• Entrez Gene: RAB7A (a.k.a. CMT2B, PRO2706, RAB7)
• Promoter: EF1a
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• Supplemental Documents:
  • pBP-mCh-Rab7.gb
• A portion of this plasmid was derived from a plasmid made by: mCherry-Rab7 sequence was amplified from Addgene plasmid #61804 and inserted into Addgene plasmid #221553 such that the mCherry-Rab7 from plasmid #61804 replaced the TBK1-GFP from plasmid 221553

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry