PiggyBac-TetO-En1-t2a-Foxa2-hygro
(Plasmid
#176483)
-
PurposeTetO-En1-t2a-Foxa2 in a PiggyBac vector with hygromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176483 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePiggybac TetO - hygromycin
- Backbone size w/o insert (bp) 8621
- Total vector size (bp) 11294
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsThe Wernig lab uses Stbl3 or JM109 for downstream applications.
-
Copy numberUnknown
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer TGACCTCCATAGAAGACACC
- 3′ sequencing primer ggaggggcaaacaacagatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PiggyBac-TetO-En1-t2a-Foxa2-hygro was a gift from Marius Wernig (Addgene plasmid # 176483 ; http://n2t.net/addgene:176483 ; RRID:Addgene_176483) -
For your References section:
Efficient generation of dopaminergic induced neuronal cells with midbrain characteristics. Ng YH, Chanda S, Janas JA, Yang N, Kokubu Y, Sudhof TC, Wernig M. Stem Cell Reports. 2021 Jul 13;16(7):1763-1776. doi: 10.1016/j.stemcr.2021.05.017. Epub 2021 Jun 24. 10.1016/j.stemcr.2021.05.017 PubMed 34171286