pKI_ΩBBMVP16&SRDXWUSm1
(Plasmid
#220349)
-
PurposeExpresses BBM-VP16 and SRDX-WUSm1 in plant cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKI1.1R
- Total vector size (bp) 14773
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameBABY BOOM
-
SpeciesA. thaliana (mustard weed)
-
Entrez GeneBBM (a.k.a. AT5G17430, BABY BOOM, T10B6.90, T10B6_90)
- Promoter CaMV 35S
-
Tag
/ Fusion Protein
- VP16 transcriptional activation domain (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer aacagtaccctccggcaacatc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameWUSCHEL
-
SpeciesA. thaliana (mustard weed)
-
Mutationtwo amino acid substitution in WUS-box: L255A L257A
-
Entrez GeneWUS (a.k.a. AT2G17950, PGA6, T27K22.18, T27K22_18, WUS1, WUSCHEL, WUSCHEL 1)
- Promoter RPS5A
-
Tag
/ Fusion Protein
- Superman Repression Domain X (SRDX) (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGTTGGGTGATGAAGATGGTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKI_ΩBBMVP16&SRDXWUSm1 was a gift from Tomoko Igawa (Addgene plasmid # 220349 ; http://n2t.net/addgene:220349 ; RRID:Addgene_220349) -
For your References section:
Autonomous differentiation of transgenic cells requiring no external hormone application: the endogenous gene expression and phytohormone behaviors. Sato Y, Minamikawa MF, Pratama BB, Koyama S, Kojima M, Takebayashi Y, Sakakibara H, Igawa T. Front Plant Sci. 2024 Apr 3;15:1308417. doi: 10.3389/fpls.2024.1308417. eCollection 2024. 10.3389/fpls.2024.1308417 PubMed 38633452