Tet-pLKO-neo
(Plasmid #21916)

• Purpose: (Empty Backbone) 3rd generation lentiviral plasmid for inducible expression of shRNA; neomycin selection. See manual for detailed protocols. No further technical support is available from the depositing laboratory.
• Depositing Lab: Dmitri Wiederschain
• Publication: Wiederschain et al Cell Cycle. 2009 Feb 1. 8(3):498-504.

Backbone

• Vector backbone: Tet-pLKO-neo
• Backbone size (bp): 10959
• Vector type: Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: recommend rec-deficient E.coli (Stbl3, SURE) at 37C
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GGCAGGGATATTCACCATTATCGTTTCAGA

Resource Information

• Supplemental Documents:
  • Tet-pLKO Manual
• Addgene Notes:
  • Addgene Diagnostic Test
• Articles Citing this Plasmid:
  • 37 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was called pLKO-Tet-On-neo in the original publication.  The name was changed to clarify that this plasmid does not contain and is not related to the trademarked Tet-On(R) system sold by Clontech.  No other changes were made.  Clontech does not support or recommend this product.  

Please look at the manual associated with this plasmid for detailed protocols. Note that no additional technical support or troubleshooting is available from the laboratory that created this plasmid beyond the published manual.

For additional information please review the following reference -
Wee, S., Wiederschain, D., Maira, S.-M., Loo, A., Miller, C., deBeaumont, R., Stegmeier, F., Yao, Y.-M., and Lengauer, C. PTEN-deficient cancers depend on PIK3CB, Proc Natl Acad Sci U S A. 105: 13057-62, 2008.

Please cite the original publication when describing the use of this plasmid in a subsequent publication: Wiederschain et al., Cell Cycle. 2009 Feb 1. 8(3):498-504

Information for Cloning Grade DNA (Catalog # 21916-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here