pBEVY-pT231 scFv-GFP
(Plasmid
#218827)
-
PurposeYeast surface display of a phospho-tau pT231 scFv and intracellular expression of GFP
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218827 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCT
-
Backbone manufacturerEric Boder
- Backbone size w/o insert (bp) 6220
- Total vector size (bp) 6958
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepT231 tau scFv
-
Alt namephospho-tau pT231 scFv
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)738
- Promoter GAL1-10
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer cctctatactttaacgtcaaggag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypT231 tau antibody gene was cloned by Heather Shih and colleagues reported in DOI 10.1074/jbc.M112.415935
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEVY-pT231 scFv-GFP was a gift from Yongku Cho (Addgene plasmid # 218827 ; http://n2t.net/addgene:218827 ; RRID:Addgene_218827) -
For your References section:
Yeast biopanning against site-specific phosphorylations in tau. Arbaciauskaite M, Pirhanov A, Ammermann E, Lei Y, Cho YK. Protein Eng Des Sel. 2023 Jan 21;36:gzad005. doi: 10.1093/protein/gzad005. 10.1093/protein/gzad005 PubMed 37294629