pLentiCMV_HyPer7RgDAAO
(Plasmid #217653)

• Purpose: Expresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membrane
• Depositing Lab: Seth Parker
• Publication: Johal et al Cell Reports, Volume 43, Issue 12, 115069

Backbone

• Vector backbone: pLenti CMV Blast Dest
• Backbone manufacturer: Eric Campeau, Paul Kaufman
• Backbone size w/o insert (bp): 9341
• Total vector size (bp): 10266
• Modifications to backbone: Inserted HyPer7-DAAO fusion at the att sites of the vector backbone.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HyPer7 D amino acid oxidase
• Alt name: HyPer7 DAAO
• Species: Neisseria meningitidis, Rhodotorula gracilis
• Insert Size (bp): 2638
• Mutation: Fused DAAO to the C-terminus of HyPer7 using a Gly-Gly-Ser-Gly link while also removing the ATG start codon from DAAO
• Promoter: CMV
• Tag / Fusion Protein:
  • Nuclear export signal (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • HyPer7 DAAO NES pLenti CMV Blast.gbk
• A portion of this plasmid was derived from a plasmid made by: Valeriy V Pak and Vsevolod V Belousov

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry