MAP4K3-GFP d344-873, K45E
(Plasmid #21735)

• Depositing Lab: L. Miguel Martins
• Publication: Lam et al Proc Natl Acad Sci U S A. 2009 Jul 8. ():.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MAP4K3
• Alt name: GLK
• Alt name: MAPKKKK3
• Alt name: RAB8IPL1
• Species: H. sapiens (human)
• Insert Size (bp): 1032
• Mutation: Deletion of the carboxy-terminus, amino-acids 344 to 873. Mutation of the ATP-binding site (K45E). This version of the kinase is catalytically inactive
• GenBank ID: BC071579
• Entrez Gene: MAP4K3 (a.k.a. GLK, MAPKKKK3, MEKKK 3, MEKKK3, RAB8IPL1)
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: CMV forward (CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: EGFP-N sequencing primer

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry