Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MAP4K3-GFP d344-873
(Plasmid #21732)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21732 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MAP4K3
  • Alt name
    GLK
  • Alt name
    MAPKKKK3
  • Alt name
    RAB8IPL1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1032
  • Mutation
    Deletion of the carboxy-terminus, amino-acids 344 to 873
  • GenBank ID
    BC071579
  • Entrez Gene
    MAP4K3 (a.k.a. GLK, MAPKKKK3, MEKKK 3, MEKKK3, RAB8IPL1)
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CMV forward (CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer EGFP-N
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MAP4K3-GFP d344-873 was a gift from L. Miguel Martins (Addgene plasmid # 21732 ; http://n2t.net/addgene:21732 ; RRID:Addgene_21732)
  • For your References section:

    MAP4K3 modulates cell death via the post-transcriptional regulation of BH3-only proteins. Lam D, Dickens D, Reid EB, Loh SH, Moisoi N, Martins LM. Proc Natl Acad Sci U S A. 2009 Jul 8. ():. 10.1073/pnas.0900608106 PubMed 19587239