p2710-pHAGE2-Ef1aL-wtYAP-UBC-tagBFP-loxP
(Plasmid
#216479)
-
Purposelentiviral dual expression of wtYAP (YAP1) and tagBFP with loxP site for Cre excision
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216479 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE2
- Total vector size (bp) 9801
-
Vector typeLentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namewtYAP (YAP1)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1613
-
Entrez GeneYAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
- Promoter EF1aL
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamHI - BglII (destroyed during cloning)
- 5′ sequencing primer gctagcggccgccATGGACTACAAAGACCATGACGGT
- 3′ sequencing primer gcgcagatctTCACACCACTTTGTACAAGAAAGTTGGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametagBFP
-
SpeciesSynthetic
-
Insert Size (bp)702
- Promoter UBC
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer aatccatatggccatgagcgagctgattaagg
- 3′ sequencing primer acgaatccatatggccatgagcgagctgattaagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.01.19.524655v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2710-pHAGE2-Ef1aL-wtYAP-UBC-tagBFP-loxP was a gift from Darrell Kotton (Addgene plasmid # 216479 ; http://n2t.net/addgene:216479 ; RRID:Addgene_216479) -
For your References section:
Generation of human alveolar epithelial type I cells from pluripotent stem cells. Burgess CL, Huang J, Bawa PS, Alysandratos KD, Minakin K, Ayers LJ, Morley MP, Babu A, Villacorta-Martin C, Yampolskaya M, Hinds A, Thapa BR, Wang F, Matschulat A, Mehta P, Morrisey EE, Varelas X, Kotton DN. Cell Stem Cell. 2024 Apr 15:S1934-5909(24)00098-5. doi: 10.1016/j.stem.2024.03.017. 10.1016/j.stem.2024.03.017 PubMed 38642558