Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTP341 pHAGE2 CMV TagBFP-3xFLAG
(Plasmid #199391)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 199391 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE2
  • Backbone size w/o insert (bp) 6454
  • Total vector size (bp) 7243
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TagBFP-3xFLAG
  • Species
    Synthetic
  • Insert Size (bp)
    789
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GTTGCCTGACAACGGGCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTP341 pHAGE2 CMV TagBFP-3xFLAG was a gift from Rebecca Voorhees (Addgene plasmid # 199391 ; http://n2t.net/addgene:199391 ; RRID:Addgene_199391)
  • For your References section:

    A nanobody-based strategy for rapid and scalable purification of human protein complexes. Stevens TA, Tomaleri GP, Hazu M, Wei S, Nguyen VN, DeKalb C, Voorhees RM, Pleiner T. Nat Protoc. 2024 Jan;19(1):127-158. doi: 10.1038/s41596-023-00904-w. Epub 2023 Nov 16. 10.1038/s41596-023-00904-w PubMed 37974029