AAVi U6_gRNA CMV_SadCas9-KRAB
(Plasmid #214609)

• Purpose: All-in-one AAVi plasmid expressing S. aureus dCas9-KRAB with sgRNA cassette
• Depositing Lab: Ralf Gilsbach
• Publication: Laurette et al Circ Res. 2023 Dec 22. doi: 10.1161/CIRCRESAHA.123.323854.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 2747
• Total vector size (bp): 7381
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: gRNA
• Alt name: nuclease-dead S. aureus Cas9
• Insert Size (bp): 120
• GenBank ID:
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: GACTATCATATGCTTACCGT

Gene/Insert 2

• Gene/Insert name: SadCas9
• Alt name: nuclease-dead S. aureus Cas9
• Species: S. aureus
• Insert Size (bp): 3564
• Mutation: D10A, N580A
• Promoter: CMV
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • NP NLS (C terminal on insert)
  • SV40 NLS (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The full insert between ITRs was cloned from a synthetic fragment.
The Sa gRNA scaffold sequence was modified from Ran et al Nature 2015 doi: 10.1038/nature14299.
The SadCas9-KRAB sequence is based on Thakore et al Nat Commun. 2018 doi: 10.1038/s41467-018-04048-4.