p104_gRNA_Sp_CD3e
(Plasmid
#213780)
-
PurposeExpresses CRISPRi gRNA for CD3e promoter and GFP. gRNA driven by mU6.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213780 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiviral
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSp gRNA
-
gRNA/shRNA sequenceGCCAAGTGAGGTAAAACCCGC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p104_gRNA_Sp_CD3e was a gift from Howard Chang (Addgene plasmid # 213780 ; http://n2t.net/addgene:213780 ; RRID:Addgene_213780) -
For your References section:
Bidirectional epigenetic editing reveals hierarchies in gene regulation. Pacalin NM, Steinhart Z, Shi Q, Belk JA, Dorovskyi D, Kraft K, Parker KR, Shy BR, Marson A, Chang HY. Nat Biotechnol. 2024 May 17. doi: 10.1038/s41587-024-02213-3. 10.1038/s41587-024-02213-3 PubMed 38760566