pAAV-CMV-SspB-EGFP-VP16-P2A-FLAG-Gal4DBD-CapN-SsrA-CapC-HA
(Plasmid
#213536)
-
PurposeExpresses the split transcription factors in mouse liver
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 3799
- Total vector size (bp) 6475
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSspB-EGFP-VP16-P2A-FLAG-Gal4DBD-CapN-SsrA-CapC-HA-HA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2676
- Promoter CMV
-
Tags
/ Fusion Proteins
- EGFP (N terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HinDIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAACAGATGGCTGGCAACTAGAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-SspB-EGFP-VP16-P2A-FLAG-Gal4DBD-CapN-SsrA-CapC-HA was a gift from Wenjing Wang (Addgene plasmid # 213536 ; http://n2t.net/addgene:213536 ; RRID:Addgene_213536) -
For your References section:
A general method for chemogenetic control of peptide function. Shen J, Geng L, Li X, Emery C, Kroning K, Shingles G, Lee K, Heyden M, Li P, Wang W. Nat Methods. 2023 Jan;20(1):112-122. doi: 10.1038/s41592-022-01697-8. Epub 2022 Dec 8. 10.1038/s41592-022-01697-8 PubMed 36481965