Skip to main content
Addgene

PB-CuO-V5 CASC3 siRes1+2 f.l. WT
(Plasmid #158540)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 158540 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PB-Cuo-MCS-IRES-GFP-EF1α-CymR-Puro
  • Backbone manufacturer
    SBI
  • Backbone size w/o insert (bp) 9509
  • Total vector size (bp) 11658
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CASC3; BTZ; MLN51
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2112
  • Entrez Gene
    CASC3 (a.k.a. BTZ, MLN51)
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe (not destroyed)
  • 3′ cloning site Not (not destroyed)
  • 5′ sequencing primer CCGATCTGGCCATACACTTG
  • 3′ sequencing primer GCCCTCACATTGCCAAAAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-CuO-V5 CASC3 siRes1+2 f.l. WT was a gift from Niels Gehring (Addgene plasmid # 158540 ; http://n2t.net/addgene:158540 ; RRID:Addgene_158540)
  • For your References section:

    CASC3 promotes transcriptome-wide activation of nonsense-mediated decay by the exon junction complex. Gerbracht JV, Boehm V, Britto-Borges T, Kallabis S, Wiederstein JL, Ciriello S, Aschemeier DU, Kruger M, Frese CK, Altmuller J, Dieterich C, Gehring NH. Nucleic Acids Res. 2020 Jul 4. pii: 5867419. doi: 10.1093/nar/gkaa564. 10.1093/nar/gkaa564 PubMed 32621609