Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMDC32B-AtMIR390a-NbSu-2
(Plasmid #213400)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213400 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMDC32
  • Backbone size w/o insert (bp) 10133
  • Total vector size (bp) 10654
  • Modifications to backbone
    BsaI site removed
  • Vector type
    Plant Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Arabidopsis MIR390a precursor including amiRNA/amiRNA* sequences for silencing N. benthamiana SULFUR gene
  • Alt name
    35S:amiR-NbSu-2
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    521
  • GenBank ID
    AT2G38325
  • Promoter 2x35S

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer attB1 (ACAAGTTTGTACAAAAAAGCAGGCT)
  • 3′ sequencing primer attB2 (ACCACTTTGTACAAGAAAGCTGGGT)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMDC32B-AtMIR390a-NbSu-2 was a gift from Alberto Carbonell (Addgene plasmid # 213400 ; http://n2t.net/addgene:213400 ; RRID:Addgene_213400)
  • For your References section:

    Systemic silencing of an endogenous plant gene by two classes of mobile 21-nucleotide artificial small RNAs. Cisneros AE, de la Torre-Montana A, Carbonell A. Plant J. 2022 May;110(4):1166-1181. doi: 10.1111/tpj.15730. Epub 2022 Mar 27. 10.1111/tpj.15730 PubMed 35277899