pMDC32B-AtMIR390a-NbSu-2
(Plasmid
#213400)
-
PurposePlant expression vector (2x35S) for expressing an amiRNA against Nicotiana benthamiana SULFUR gene from AtMIR390a precursor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMDC32
- Backbone size w/o insert (bp) 10133
- Total vector size (bp) 10654
-
Modifications to backboneBsaI site removed
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArabidopsis MIR390a precursor including amiRNA/amiRNA* sequences for silencing N. benthamiana SULFUR gene
-
Alt name35S:amiR-NbSu-2
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)521
-
GenBank IDAT2G38325
- Promoter 2x35S
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer attB1 (ACAAGTTTGTACAAAAAAGCAGGCT)
- 3′ sequencing primer attB2 (ACCACTTTGTACAAGAAAGCTGGGT) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMDC32B-AtMIR390a-NbSu-2 was a gift from Alberto Carbonell (Addgene plasmid # 213400 ; http://n2t.net/addgene:213400 ; RRID:Addgene_213400) -
For your References section:
Systemic silencing of an endogenous plant gene by two classes of mobile 21-nucleotide artificial small RNAs. Cisneros AE, de la Torre-Montana A, Carbonell A. Plant J. 2022 May;110(4):1166-1181. doi: 10.1111/tpj.15730. Epub 2022 Mar 27. 10.1111/tpj.15730 PubMed 35277899