pMT692 ORF2p-3C-3xF (1-1275, ORFeus-Hs) in pDARMO-PolH2.1
(Plasmid #213025)

• Purpose: Expresses full length human LINE-1 ORF2p Core (1-1275) with a C-terminal 3xFlag tag for baculovirus production in insect cells
• Depositing Lab: Martin S. Taylor
• Publication: Structures, Functions, and Adaptations of the Human LINE-1 ORF2 Protein (unpublished)

Backbone

• Vector backbone: pDARMO-PolH2.1
• Backbone manufacturer: Kacper Rogala, modified by Martin Taylor
• Backbone size w/o insert (bp): 3541
• Total vector size (bp): 7481
• Modifications to backbone: Addition of Golden Gate acceptor sites (00-02) for directional assembly of MultiBac type plasmids.
• Vector type: Insect Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Grow at 30C in NEBStable if additional inserts are included in a MultiBac
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LINE-1 ORF2p (1-1275)
• Alt name: ORF2p
• Alt name: ORF2
• Alt name: LORF2_HUMAN
• Species: H. sapiens (human)
• Insert Size (bp): 3940
• GenBank ID: AAC51271.1
• Promoter: Polyhedrin
• Tag / Fusion Protein:
  • 3C-3xFlag (ORF2p) (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: Polyhedrin-Forward (GGAGATAATTAAAATGATAACCATCTCGC)
• 3′ sequencing primer: Polyhedrin-pA-Rev (TCGAACCTTTATTACAAAACAAAACACA)

Resource Information

• Supplemental Documents:
  • pMT692 ORF2-3C-3xF in pDARMO-PolH2.1.Assemble(ggAB).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Includes polyhedrin terminator and backbone is designed to be useful in MultiBac scenarios. Note that relative to some insect vectors, the Tn7 sites are reversed, so the insert may be flipped in the destination bacmid and PCR primers may need to be swapped accordingly.

The construct is based on the synthetic L1 ORFeus-Hs sequence generated in the lab of Jef Boeke (see W. An et al., Mobile DNA 2, 2011 https://doi.org/10.1186/1759-8753-2-2).

For more on pDARMO vectors see Rogala, K. B. et al. Structural basis for the docking of mTORC1 on the lysosomal surface. Science 366, 468-475 (2019). https://doi.org/10.1126/science.aay0166