Skip to main content
Addgene

pMT692 ORF2p-3C-3xF (1-1275, ORFeus-Hs) in pDARMO-PolH2.1
(Plasmid #213025)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213025 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDARMO-PolH2.1
  • Backbone manufacturer
    Kacper Rogala, modified by Martin Taylor
  • Backbone size w/o insert (bp) 3541
  • Total vector size (bp) 7481
  • Modifications to backbone
    Addition of Golden Gate acceptor sites (00-02) for directional assembly of MultiBac type plasmids.
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Grow at 30C in NEBStable if additional inserts are included in a MultiBac
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LINE-1 ORF2p (1-1275)
  • Alt name
    ORF2p
  • Alt name
    ORF2
  • Alt name
    LORF2_HUMAN
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3940
  • GenBank ID
    AAC51271.1
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • 3C-3xFlag (ORF2p) (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer Polyhedrin-Forward (GGAGATAATTAAAATGATAACCATCTCGC)
  • 3′ sequencing primer Polyhedrin-pA-Rev (TCGAACCTTTATTACAAAACAAAACACA)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Includes polyhedrin terminator and backbone is designed to be useful in MultiBac scenarios. Note that relative to some insect vectors, the Tn7 sites are reversed, so the insert may be flipped in the destination bacmid and PCR primers may need to be swapped accordingly.

The construct is based on the synthetic L1 ORFeus-Hs sequence generated in the lab of Jef Boeke (see W. An et al., Mobile DNA 2, 2011 https://doi.org/10.1186/1759-8753-2-2)

For more on pDARMO vectors see Rogala, K. B. et al. Structural basis for the docking of mTORC1 on the lysosomal surface. Science 366, 468-475 (2019). https://doi.org/10.1126/science.aay0166

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMT692 ORF2p-3C-3xF (1-1275, ORFeus-Hs) in pDARMO-PolH2.1 was a gift from Martin S. Taylor (Addgene plasmid # 213025 ; http://n2t.net/addgene:213025 ; RRID:Addgene_213025)

  • For your References section:

    Structures, functions and adaptations of the human LINE-1 ORF2 protein. Baldwin ET, van Eeuwen T, Hoyos D, Zalevsky A, Tchesnokov EP, Sanchez R, Miller BD, Di Stefano LH, Ruiz FX, Hancock M, Isik E, Mendez-Dorantes C, Walpole T, Nichols C, Wan P, Riento K, Halls-Kass R, Augustin M, Lammens A, Jestel A, Upla P, Xibinaku K, Congreve S, Hennink M, Rogala KB, Schneider AM, Fairman JE, Christensen SM, Desrosiers B, Bisacchi GS, Saunders OL, Hafeez N, Miao W, Kapeller R, Zaller DM, Sali A, Weichenrieder O, Burns KH, Gotte M, Rout MP, Arnold E, Greenbaum BD, Romero DL, LaCava J, Taylor MS. Nature. 2024 Feb;626(7997):194-206. doi: 10.1038/s41586-023-06947-z. Epub 2023 Dec 14. 10.1038/s41586-023-06947-z PubMed 38096902
Related items:
Commonly requested with: