Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBOBI TP53 S46D
(Plasmid #213002)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213002 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBOBI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P53
  • Alt name
    TP53
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1182
  • Mutation
    S46D
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
  • Promoter cmv

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer PLNCX-F
  • 3′ sequencing primer TACTCACCCCAACAGCTGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBOBI TP53 S46D was a gift from Sheng-cai Lin (Addgene plasmid # 213002 ; http://n2t.net/addgene:213002 ; RRID:Addgene_213002)
  • For your References section:

    Low glucose metabolite 3-phosphoglycerate switches PHGDH from serine synthesis to p53 activation to control cell fate. Wu YQ, Zhang CS, Xiong J, Cai DQ, Wang CZ, Wang Y, Liu YH, Wang Y, Li Y, Wu J, Wu J, Lan B, Wang X, Chen S, Cao X, Wei X, Hu HH, Guo H, Yu Y, Ghafoor A, Xie C, Wu Y, Xu Z, Zhang C, Zhu M, Huang X, Sun X, Lin SY, Piao HL, Zhou J, Lin SC. Cell Res. 2023 Nov;33(11):835-850. doi: 10.1038/s41422-023-00874-4. Epub 2023 Sep 19. 10.1038/s41422-023-00874-4 PubMed 37726403