Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAX-EGFP-CIP4
(Plasmid #178363)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178363 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAX
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 7082
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cdc42 Interacting Protein 4
  • Alt name
    CIP4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1635
  • Entrez Gene
    TRIP10 (a.k.a. CIP4, HSTP, STOT, STP, TRIP-10)
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGCTCCTGGGCAACGTGC
  • 3′ sequencing primer CACTCGGAAGGACATATGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAX-EGFP-CIP4 was a gift from Erik Dent (Addgene plasmid # 178363 ; http://n2t.net/addgene:178363 ; RRID:Addgene_178363)
  • For your References section:

    Opposing functions of F-BAR proteins in neuronal membrane protrusion, tubule formation, and neurite outgrowth. Taylor KL, Taylor RJ, Richters KE, Huynh B, Carrington J, McDermott ME, Wilson RL, Dent EW. Life Sci Alliance. 2019 Jun 3;2(3). pii: 2/3/e201800288. doi: 10.26508/lsa.201800288. Print 2019 Jun. 10.26508/lsa.201800288 PubMed 31160379