L1
(Plasmid #21200)

• Depositing Lab: Paul Khavari
• Publication: Scholl et al Cancer Res. 2004 Sep 1;64(17):6035-40

Backbone

• Vector backbone: LZRS-RfA
• Backbone size w/o insert (bp): 11100
• Vector type: Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: STBL2
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Mek2
• Alt name: MAP2K2
• Alt name: ER-{alpha}
• Alt name: Esr1
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 2200
• Mutation: Mek2 K101A fused to ER*, catalytically inactive
• Entrez Gene: Esr1 (a.k.a. ER, ER-alpha, ERa, ERalpha, ESR, Estr, Estra, Nr3a1)
• Entrez Gene: MAP2K2 (a.k.a. CFC4, MAPKK2, MEK2, MKK2, PRKMK2)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ cloning site: attR (not destroyed)
• 3′ cloning site: attR (not destroyed)
• 5′ sequencing primer: TGGATACACGCCGCCCACGTG
• 3′ sequencing primer: ATCGTCGACCACTGTGCTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry