Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRRL-VinculinVenus-S1033D
(Plasmid #211897)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211897 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRL
  • Backbone size w/o insert (bp) 6129
  • Total vector size (bp) 10778
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VinculinVenus-S1033D
  • Alt name
    VinV-S1033D
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    4649
  • Mutation
    mutated vinculin serine 1033 to aspartic acid (S1033D), creates phosphomimetic mutant
  • Entrez Gene
    VCL (a.k.a. VINC1)
  • Promoter CMV
  • Tag / Fusion Protein
    • VenusA206K (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGTACAGTGCAGGGGAAAG
  • 3′ sequencing primer GTTAAGAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Martin Schwartz (Addgene #27300)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL-VinculinVenus-S1033D was a gift from Brenton Hoffman (Addgene plasmid # 211897 ; http://n2t.net/addgene:211897 ; RRID:Addgene_211897)
  • For your References section:

    Coupling during collective cell migration is controlled by a vinculin mechanochemical switch. Shoyer TC, Gates EM, Cabe JI, Urs AN, Conway DE, Hoffman BD. Proc Natl Acad Sci U S A. 2023 Dec 12;120(50):e2316456120. doi: 10.1073/pnas.2316456120. Epub 2023 Dec 6. 10.1073/pnas.2316456120 PubMed 38055737