Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

human oct4-GFP
(Plasmid #21153)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21153 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    BluescriptKSII
  • Backbone manufacturer
    stratagene
  • Backbone size w/o insert (bp) 2381
  • Vector type
    Mammalian Expression ; human targeting
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    XL1blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hOCT4-GFP
  • Alt name
    hCol1a1 targeting arms
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    120006
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGATAAGCTTGGTACCGAGC
  • 3′ sequencing primer CCAACACACTATTGCAATGAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    human oct4-GFP was a gift from Rudolf Jaenisch (Addgene plasmid # 21153 ; http://n2t.net/addgene:21153 ; RRID:Addgene_21153)
  • For your References section:

    Nanoparticles for gene transfer to human embryonic stem cell colonies. Green JJ, Zhou BY, Mitalipova MM, Beard C, Langer R, Jaenisch R, Anderson DG. Nano Lett. 2008 Oct . 8(10):3126-30. 10.1021/nl8012665 PubMed 18754690