Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pkk223_MsMutY_D150N_E49Q
(Plasmid #210794)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210794 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pkk223
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MutY (adenine glycosylase)
  • Species
    Marinosulfonomonas (genus)
  • Mutation
    D150N_E49Q

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gttttttgcgccgacatcataacggttc
  • 3′ sequencing primer gcttctgcgttctgatttaatctgtatcaggctg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pkk223_MsMutY_D150N_E49Q was a gift from Martin Horvath (Addgene plasmid # 210794 ; http://n2t.net/addgene:210794 ; RRID:Addgene_210794)
  • For your References section:

    Metagenome mining and functional analysis reveal oxidized guanine DNA repair at the Lost City Hydrothermal Field. Utzman PH, Mays VP, Miller BC, Fairbanks MC, Brazelton WJ, Horvath MP. PLoS One. 2024 May 8;19(5):e0284642. doi: 10.1371/journal.pone.0284642. eCollection 2024. 10.1371/journal.pone.0284642 PubMed 38718041