Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

plentiCRISPRv2-PURO-LYSET-gRNA1
(Plasmid #210489)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210489 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LYSET-gRNA1
  • gRNA/shRNA sequence
    TGCCTTTTTGGGTGTGGACA
  • Species
    H. sapiens (human)
  • Entrez Gene
    LYSET (a.k.a. C14orf109, DMAN, GCAF, TMEM251)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plentiCRISPRv2-PURO-LYSET-gRNA1 was a gift from Jan Carette (Addgene plasmid # 210489 ; http://n2t.net/addgene:210489 ; RRID:Addgene_210489)
  • For your References section:

    The human disease gene LYSET is essential for lysosomal enzyme transport and viral infection. Richards CM, Jabs S, Qiao W, Varanese LD, Schweizer M, Mosen PR, Riley NM, Klussendorf M, Zengel JR, Flynn RA, Rustagi A, Widen JC, Peters CE, Ooi YS, Xie X, Shi PY, Bartenschlager R, Puschnik AS, Bogyo M, Bertozzi CR, Blish CA, Winter D, Nagamine CM, Braulke T, Carette JE. Science. 2022 Sep 8:eabn5648. doi: 10.1126/science.abn5648. 10.1126/science.abn5648 PubMed 36074821