plentiCRISPRv2-PURO-LYSET-gRNA2
(Plasmid
#210490)
-
PurposeCRISPR pooled KO of human LYSET
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210490 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLentiCRISPRv2
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLYSET-gRNA2
-
gRNA/shRNA sequenceATAGTAAAATGCTGCTGCAC
-
SpeciesH. sapiens (human)
-
Entrez GeneLYSET (a.k.a. C14orf109, DMAN, GCAF, TMEM251)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plentiCRISPRv2-PURO-LYSET-gRNA2 was a gift from Jan Carette (Addgene plasmid # 210490 ; http://n2t.net/addgene:210490 ; RRID:Addgene_210490) -
For your References section:
The human disease gene LYSET is essential for lysosomal enzyme transport and viral infection. Richards CM, Jabs S, Qiao W, Varanese LD, Schweizer M, Mosen PR, Riley NM, Klussendorf M, Zengel JR, Flynn RA, Rustagi A, Widen JC, Peters CE, Ooi YS, Xie X, Shi PY, Bartenschlager R, Puschnik AS, Bogyo M, Bertozzi CR, Blish CA, Winter D, Nagamine CM, Braulke T, Carette JE. Science. 2022 Sep 8:eabn5648. doi: 10.1126/science.abn5648. 10.1126/science.abn5648 PubMed 36074821