-
PurposeMonitoring neuropeptide release
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207661 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-phSyn1(S)-FLEX-hGFP-T2A-SypeGFP-WPRE
- Backbone size w/o insert (bp) 4434
- Total vector size (bp) 6669
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCytochrome b-561
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)753
-
MutationHistidine 86 and 159 to alanines, inserted 2 X SEP into 339-340 of Cyb561
-
GenBank IDNM_007805.5
-
Entrez GeneCyb561
- Promoter hSynapsin
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTGTACAGGTCTGCTTTGTATAGTTCATCCATGCCATG
- 3′ sequencing primer GATGAACTATACAAAGACTACCACAAGAAGAAGGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.01.19.524797 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn1-FLEX-CybSEP2-WPRE was a gift from Sung Han (Addgene plasmid # 207661 ; http://n2t.net/addgene:207661 ; RRID:Addgene_207661) -
For your References section:
Novel genetically encoded tools for imaging or silencing neuropeptide release from presynaptic terminals in vivo. Kim D-I, Park S, Ye M, Chen JY, Jhang J, Hunker AC, Zweifel LS, Palmiter RD, Han S. bioRxiv 2023.01.19.524797 10.1101/2023.01.19.524797