Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lenti-RNF2-ngRNA+41_EF1a-puroR
(Plasmid #207358)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207358 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPRv2_deltaCas9
  • Backbone manufacturer
    Carlon lab (M. Bulcaen)
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RNF2 +41 ngRNA
  • gRNA/shRNA sequence
    tcaaccattaagcaaaacat
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-RNF2-ngRNA+41_EF1a-puroR was a gift from Marianne Carlon (Addgene plasmid # 207358 ; http://n2t.net/addgene:207358 ; RRID:Addgene_207358)
  • For your References section:

    Prime editing functionally corrects cystic fibrosis-causing CFTR mutations in human organoids and airway epithelial cells. Bulcaen M, Kortleven P, Liu RB, Maule G, Dreano E, Kelly M, Ensinck MM, Thierie S, Smits M, Ciciani M, Hatton A, Chevalier B, Ramalho AS, Casadevall I Solvas X, Debyser Z, Vermeulen F, Gijsbers R, Sermet-Gaudelus I, Cereseto A, Carlon MS. Cell Rep Med. 2024 May 21;5(5):101544. doi: 10.1016/j.xcrm.2024.101544. Epub 2024 May 1. 10.1016/j.xcrm.2024.101544 PubMed 38697102