TPC2-G-GECO1.2
(Plasmid #207141)

• Purpose: Fusion of Ca2+ reporter and lysosomal Ca2+-permeable channel
• Depositing Lab: Antony Galione
• Publication: Davis et al EMBO J. 2020 Jul 15;39(14):e104058. doi: 10.15252/embj.2019104058. Epub 2020 Jun 8.

Backbone

• Vector backbone: pDendra2-N
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 7513
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TPC2N2
• Alt name: TPC2, two-pore channel 2
• Species: H. sapiens (human)
• Insert Size (bp): 2256
• GenBank ID: BC141195
• Entrez Gene: TPCN2 (a.k.a. SHEP10, TPC2)
• Promoter: CMV
• Tag / Fusion Protein:
  • G-GECO1.2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CAACGGGACTTTCCAAAATG
• 3′ sequencing primer: gaaatttgtgatgctattgc

Resource Information

• Supplemental Documents:
  • TPC2-G-GECO1.2.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry