TRPML1-mCherry
(Plasmid
#135189)
-
PurposeExpresses TRPML1 with C-terminus mCherry tag in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135189 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVXpuro
- Backbone size w/o insert (bp) 8080
- Total vector size (bp) 10537
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRPML1
-
Alt nameMcoln1
-
SpeciesM. musculus (mouse)
-
GenBank IDBC005651
-
Entrez GeneMcoln1 (a.k.a. 2210015I05Rik, TRPML1, mucolipidin)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CAACGGGACTTTCCAAAATG
- 3′ sequencing primer CCAGAGGCCACTTGTGTAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySource Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
I.M.A.G.E. Fully Sequenced cDNA Clone IRAKp961C166Q
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRPML1-mCherry was a gift from Antony Galione (Addgene plasmid # 135189 ; http://n2t.net/addgene:135189 ; RRID:Addgene_135189) -
For your References section:
Expression of Ca(2)(+)-permeable two-pore channels rescues NAADP signalling in TPC-deficient cells. Ruas M, Davis LC, Chen CC, Morgan AJ, Chuang KT, Walseth TF, Grimm C, Garnham C, Powell T, Platt N, Platt FM, Biel M, Wahl-Schott C, Parrington J, Galione A. EMBO J. 2015 Jul 2;34(13):1743-58. doi: 10.15252/embj.201490009. Epub 2015 Apr 14. 10.15252/embj.201490009 PubMed 25872774