Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmirGLO-3'UTR mouse Il13
(Plasmid #207125)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207125 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmirGLO Dual-Luciferase miRNA Target Expression Vector
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 7362
  • Total vector size (bp) 8091
  • Modifications to backbone
    added EcoRI and SmaI restriction enzyme sites in the multiple cloning site
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Interleukin 13 (Il13) 3'UTR
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    741
  • GenBank ID
    NM_008355.3
  • Entrez Gene
    Il13 (a.k.a. Il-13)
  • Promoter PGK promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmirGLO-3'UTR mouse Il13 was a gift from Silvia Monticelli (Addgene plasmid # 207125 ; http://n2t.net/addgene:207125 ; RRID:Addgene_207125)
  • For your References section:

    The mRNA methyltransferase Mettl3 modulates cytokine mRNA stability and limits functional responses in mast cells. Leoni C, Bataclan M, Ito-Kureha T, Heissmeyer V, Monticelli S. Nat Commun. 2023 Jun 29;14(1):3862. doi: 10.1038/s41467-023-39614-y. 10.1038/s41467-023-39614-y PubMed 37386028