pB-Ric8b-Integration
(Plasmid
#129457)
-
PurposepiggyBac transposon vector that Inducibly (Tet-On) expresses Ric8b
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepB-CMV expression vector
-
Backbone manufacturerSBI
- Backbone size w/o insert (bp) 6963
- Total vector size (bp) 8646
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRic8b
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1683
-
GenBank IDAY940666.1
-
Entrez GeneRic8b (a.k.a. BC051080, Ric-8, Ric-8b)
- Promoter TRE (Tet-On)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTCCATAGAAGACACCGGGA
- 3′ sequencing primer ggtacacaatttttgagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-Ric8b-Integration was a gift from Sriram Kosuri (Addgene plasmid # 129457 ; http://n2t.net/addgene:129457 ; RRID:Addgene_129457) -
For your References section:
A Scalable, Multiplexed Assay for Decoding GPCR-Ligand Interactions with RNA Sequencing. Jones EM, Jajoo R, Cancilla D, Lubock NB, Wang J, Satyadi M, Cheung R, de March C, Bloom JS, Matsunami H, Kosuri S. Cell Syst. 2019 Mar 27;8(3):254-260.e6. doi: 10.1016/j.cels.2019.02.009. Epub 2019 Mar 20. 10.1016/j.cels.2019.02.009 PubMed 30904378