PER2:Luc Plasmid
(Plasmid #206875)

• Purpose: Per2 promoter luciferase reporter
• Depositing Lab: Michelle Farkas
• Publication: Lin et al Integr Cancer Ther. 2019 Jan-Dec;18:1534735419836494. doi: 10.1177/1534735419836494.

Backbone

• Vector backbone: pMA3160
• Backbone manufacturer: Alexeyev Lab
• Backbone size w/o insert (bp): 8331
• Total vector size (bp): 8519
• Modifications to backbone: Inserted a Per2 promoter gene upstream of the luciferase gene.
• Vector type: Mammalian Expression, Lentiviral, Luciferase
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Period 2
• Alt name: Per2
• Species: M. musculus (mouse)
• Insert Size (bp): 208
• Entrez Gene: Per2 (a.k.a. mKIAA0347, mPer2)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GAATTCAGCGTAGCTCTCAGGTTCCG
• 3′ sequencing primer: CCTTATGCAGTTGCTCTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For generation of PER2-luciferase (PER2:Luc) plasmid, a 159-bp EcoRI/NotI fragment was isolated from a pGL3 basic PER2 construct, obtained from Addgene (plasmid #48747, deposited by Dr Joseph Takahashi). The PER2 promoter-containing fragment was subcloned into the lentiviral construct pMA3160 (Addgene plasmid #35043, deposited by Dr Mikhail Alexeyev) to generate a PER2-luciferase reporter construct.