pcDNA3.1+FLAG-KrascomG12D
(Plasmid
#206844)
-
PurposeTo express mouse Kras encoded by common mouse codons (to increase expression) and with a G12D mutation with an N-terminal FLAG tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206844 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1+
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6020
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKras
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)621
-
MutationCodons altered to most optimum based on mouse codon usage. We changed Glycine 12 to Aspartic Acid
-
GenBank IDNM_001403240.1
-
Entrez GeneKras (a.k.a. K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTGT
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThermo Gene ART Gene Synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1+FLAG-KrascomG12D was a gift from Christopher Counter (Addgene plasmid # 206844 ; http://n2t.net/addgene:206844 ; RRID:Addgene_206844) -
For your References section:
Genetically manipulating endogenous Kras levels and oncogenic mutations in vivo influences tissue patterning of murine tumorigenesis. Le Roux O, Pershing NLK, Kaltenbrun E, Newman NJ, Everitt JI, Baldelli E, Pierobon M, Petricoin EF, Counter CM. Elife. 2022 Sep 7;11:e75715. doi: 10.7554/eLife.75715. 10.7554/eLife.75715 PubMed 36069770