-
PurposeAka-Luciferase reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti PGK Neo DEST (Addgene #19067)
-
Backbone manufacturerEric Campeau & Paul Kaufman
- Backbone size w/o insert (bp) 9780
- Total vector size (bp) 10575
-
Vector typeLentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVenus-Akaluciferase
-
SpeciesSynthetic; Aequorea victoria (Venus) and Photinus pyralis (Akaluciferase)
-
Insert Size (bp)2400
- Promoter hPGK
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer Akaluc-F1 CACCATGGTGAGCAAGGGCGA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe Venus-Akaluc insert was obtained from a plasmid that we received with an MTA from the RIKEN BRC (bioresource center), Tsukuba, Japan
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-PGK-Venus-Akaluc (neo) was a gift from Roland Friedel (Addgene plasmid # 124701 ; http://n2t.net/addgene:124701 ; RRID:Addgene_124701) -
For your References section:
Akaluc bioluminescence offers superior sensitivity to track in vivo glioma expansion. Bozec D, Sattiraju A, Bouras A, Jesu Raj JG, Rivera D, Huang Y, Junqueira Alves C, Tejero R, Tsankova NM, Zou H, Hadjipanayis C, Friedel RH. Neurooncol Adv. 2020 Oct 10;2(1):vdaa134. doi: 10.1093/noajnl/vdaa134. eCollection 2020 Jan-Dec. 10.1093/noajnl/vdaa134 PubMed 33241215