AAV-KP1
(Plasmid #206504)

• Purpose: AAV packaging vector containing AAV2 rep and KP1 cap and partial AAV2 p5 promoter
• Depositing Lab: Mark Kay
• Publication: Pekrun et al JCI Insight. 2019 Nov 14;4(22). pii: 131610. doi: 10.1172/jci.insight.131610.

Backbone

• Vector backbone: AAV2 rep, partial p5 in generic backbone
• Backbone size w/o insert (bp): 5116
• Total vector size (bp): 7333
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable ;
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KP1 capsid
• Species: adeno-associated virus
• Insert Size (bp): 2214
• GenBank ID: MN428626.1
• Promoter: p5

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Swa I (not destroyed)
• 3′ cloning site: Age I (not destroyed)
• 5′ sequencing primer: TGGATGACTGCATCTTTGAA
• 3′ sequencing primer: GCAGGTTTAAACGAATTC

Resource Information

• Supplemental Documents:
  • pAAV_KP1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry