Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC57-CmYLCV
(Plasmid #205245)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205245 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC57
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CmYLCV-csy4_binding_site-esgRNA-tevopreQ1-csy4_binding_site
  • Alt name
    CmYLCV-epegRNA
  • gRNA/shRNA sequence
    gtttaagagctatgctggaaacagcatagcaagtttaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
  • Species
    Synthetic
  • Promoter CmYLCV

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC57-CmYLCV was a gift from Zong Yuan (Addgene plasmid # 205245 ; http://n2t.net/addgene:205245 ; RRID:Addgene_205245)
  • For your References section:

    Efficient and versatile multiplex prime editing in hexaploid wheat. Ni P, Zhao Y, Zhou X, Liu Z, Huang Z, Ni Z, Sun Q, Zong Y. Genome Biol. 2023 Jun 29;24(1):156. doi: 10.1186/s13059-023-02990-1. 10.1186/s13059-023-02990-1 PubMed 37386475