pUC57-CmYLCV
(Plasmid
#205245)
-
PurposeFor plant prime editing in wheat plants or monocotyledons protoplasts
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC57
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCmYLCV-csy4_binding_site-esgRNA-tevopreQ1-csy4_binding_site
-
Alt nameCmYLCV-epegRNA
-
gRNA/shRNA sequencegtttaagagctatgctggaaacagcatagcaagtttaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
-
SpeciesSynthetic
- Promoter CmYLCV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13F
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC57-CmYLCV was a gift from Zong Yuan (Addgene plasmid # 205245 ; http://n2t.net/addgene:205245 ; RRID:Addgene_205245) -
For your References section:
Efficient and versatile multiplex prime editing in hexaploid wheat. Ni P, Zhao Y, Zhou X, Liu Z, Huang Z, Ni Z, Sun Q, Zong Y. Genome Biol. 2023 Jun 29;24(1):156. doi: 10.1186/s13059-023-02990-1. 10.1186/s13059-023-02990-1 PubMed 37386475
Map uploaded by the depositor.
